The Evidence for SARS-CoV-2

27 August 2021 - 3:26 pm

A Freedom of Information Request to Public Health England (PHE) asking for a copy or reference to the scientific evidence of the isolation of the SARS-CoV-2 virus was answered recently.

The request specifically asked for the isolation to have been taken from an infected person and not compromised or contaminated with other genetic material, or cultured using animal cells, cancer cells or transfected cells.

They answered very quickly, within a couple of days which is surprising as other Freedom of Information Requests are way overdue because they are so busy. In this case, it is likely because they have a stock answer to this question which was initially to define the word isolated in “PHE’s microbiology terms”, which according to them means “culture in a laboratory”. This redefinition of the word “isolation” is highly convenient for them. They do acknowledge that the word “isolation” is “used sometimes interchangeably to mean isolation from a patient or clinical material” but then go on to dismiss the definition supplied in the actual request and declare that it “usually implies that the organism has been grown in culture”. Never mind what was asked, here’s what PHE want to answer.

This was to be expected, as was the “evidence” they supplied. According to them “the Virus Reference Laboratory at PHE, Colindale, London has grown the virus, SARS-CoV-2”. How? Well they use a virus culture method that “has been published in the following peer-reviewed paper: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.32.2001483” and we’ll take a look at that document now.

This “peer-reviewed” paper is from August 2020 and is titled “Duration of infectiousness and correlation with RT-PCR cycle threshold values in cases of COVID-19, England, January to May 2020” and interestingly states the following:

Virus detection by reverse transcription-PCR (RT-PCR) from respiratory samples is widely used to diagnose and monitor SARS-CoV-2 infection and, increasingly, to infer infectivity of an individual. However, RT-PCR does not distinguish between infectious and non-infectious virus. Propagating virus from clinical samples confirms the presence of infectious virus but is not widely available, requires biosafety level 3 facilities, and the results are not timely to inform public health actions.

https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.32.2001483

Yes, there it is in black-and-white, in the paper PHE claim proves the existence of SARS-CoV-2 and how they “isolated” it, it states:

“RT-PCR does not distinguish between infectious and non-infectious virus.”

Of course we knew this. Anyone who’s been paying attention and spotted the weasel words and ambiguous statements from PHE and Government officials knows that the “Gold Standard” test cannot test for an actual virus, nor anything related to infectivity. Hence most of the “positive cases” that have been used to shut down countries and destroy lives cannot tell if the thing it allegedly detects is infectious, and that’s because all it does is replicate fragments of genetic material with a process. It is a lab tool, not a test. The inventor of PCR, Nobel Prize winner Kary Mullis who is unfortunately no longer alive to point out said as much.

The importance of the statement that RT-PCR can’t tell the difference between infectious and non-infectious cannot be overstated. This should be headline news, but it won’t be.

This article and the FOI request is really about the “isolation” of SARS-CoV-2 and how this was achieved though, so not to minimise the magnitude of the admission of that thing we all knew, in a “peer-reviewed” paper cited by Public Health England no less, let us continue.

In the paper cited by PHE in their FOI response there is a section titled “Isolation of infectious virus from respiratory samples”. This section describes their attempts to culture the virus and how they managed to do it. If you recall the question was also quite specific and excluded the use of cultures using animal cells, cancer cells or transfected cells. I will provide some more information about those various kinds of cultures later on, but it is important to see in their cited paper they describe the process as starting with obtaining samples…

from a range of clinical scenarios including community and healthcare worker surveillance, symptomatic persons tested as part of the early epidemic response and samples acquired in outbreak investigations. Selection of asymptomatic cases was through swabbing of contacts or facility/family/household testing in the context of outbreak investigations; we cannot be certain of their date of exposure or start of infection.

OK, seems reasonable. So how do they then isolate the virus from those samples? Well they don’t. The paper explains that…

Vero E6 cells were inoculated with clinical specimens and incubated at 37 °C, 5% CO₂. Cells were inspected for cytopathic effect daily up to 14 days.

A cytopathic effect is (according to Wikipedia) “structural changes in host cells that are caused by viral invasion” and in this case this will be the “Vero E6 cells” as the host cells. What are Vero E6 cells? Well Vero E6 is a cell line that was originally from kidney epithelial cells extracted from an African green monkey back in 1962. A monkey cell. But no ordinary monkey cell as we shall see. As explained on Wikipedia the Vero cells are interferon-deficient. And what are interferons? Helpfully Wikipedia explains that…

Interferons (IFNs) are a group of signaling proteins made and released by host cells in response to the presence of several viruses. In a typical scenario, a virus-infected cell will release interferons causing nearby cells to heighten their anti-viral defenses.

IFNs belong to the large class of proteins known as cytokines, molecules used for communication between cells to trigger the protective defenses of the immune system that help eradicate pathogens. Interferons are named for their ability to “interfere” with viral replication by protecting cells from virus infections. IFNs also have various other functions: they activate immune cells, such as natural killer cells and macrophages; they increase host defenses by up-regulating antigen presentation by virtue of increasing the expression of major histocompatibility complex (MHC) antigens.

https://en.wikipedia.org/wiki/Interferon

The cultures are all done in vitro of course, which means they are performed with microorganisms, cells, or biological molecules outside their normal biological context, i.e. outside a living body with a functioning immune system and all that goes with being alive such as the ability to take action to assist with any healing that may need to be done, such as safe, proven and effective medical treatments. None of that is available in these experiments because these are cell lines and cultures in a “test tube” environment.

So Public Health England are claiming that they have “isolated” the SARS-CoV-2 virus by managing to culture some genetic material in immuno-deficient monkey kidney cells in a lab that matches some sequence that they claim is SARS-CoV-2. From that claim then comes all the other claims such as it’s infectious because they are “detecting the virus” they allege to have isolated in people with the PCR test.

On the EuroSurveillance website there is an article from January 2020 titled “Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR” and in this article it explains a bit more about what they are checking for when testing for SARS-CoV-2. There are 3 main genes they can check for, though a test doesn’t have to check for all three. They have a table, and I’ll list the contents of the table shortly but you can see it at this link too.

For reference, the main components of genetic material that are within all life-forms on Earth are nucleotides that have three chemical sub-units, one of which is a type of sugar molecule that is either ribose which means it is RNA or deoxyribose which is DNA. In DNA the bases are adenine (A), cytosine (C), guanine (G), and thymine (T). In RNA, the base uracil (U) replaces thymine (T).

These bases have complimentary pairs, so A always binds with T, and C always binds with G. The two twisted strands of the DNA double-helix are held together by these base-pairs like rungs that hold the two upright parts of a ladder together. Here is a graphic to illustrate:

How PCR works is by following these steps (simplified, for a full explanation see these pages on Wikipedia):

1. The two strands of the DNA double-helix are separated, leaving a single base at each point the pair joined the strands
2. Genetic material called primers bind to the strands
3. An extension in the strands occurs via a process called polymerisation
4. New strands form via the newly added nucleotides
5. Sections of these polymerised strands form templates for other primers
6. A doubling occurs as the single separated strands have effectively filled in the blanks with primers and dNTPs as G always binds with C, and T always binds with A

There are a number of challenges with the process. Its now legendary sensitivity which we’re told is what makes it so accurate is a disadvantage in practice as amplification of spurious DNA products can easily occur, among other things. It is a useful lab tool, but not a diagnostic test. This is all rather unsurprising because it was designed as a lab tool, not as a diagnostic test.

There is more complexity to this and I am not attempting an oversimplification for any other reason than to provide a basic understanding of the process. Knowing that process and the way DNA is formed, with the G/C T/A base pairs is relevant when looking at the table I mentioned earlier. The RT-PCR “test” for the alleged 2019 “novel coronavirus” as I mentioned checks for sections of three possible genes that are alleged to be in the SARS-CoV-2 genome. They are:

RdRP gene
E gene
N gene

These genes have several sequences that they allege to find that then match the respective part of the full SARS-CoV-2 genome. These sequences look like this:

GTGARATGGTCATGTGTGGCGG (this is RdRP_SARSr-f, one of four possible sections they check)
ACAGGTACGTTAATAGTTAATAGCGT (this is E_Sarbeco_F, one of three)
CACATTGGCACCCGCAATC (this is N_Sarbeco_F, one of three)

The complete genome of SARS-CoV-2 is 29,903 base-pairs long according to this page on the US NIH website. Obviously one could conceivably think this complete genome must be an “isolation” of the SARS-CoV-2 virus and it would appear we are supposed to think that. Trusting Chinese labs might not be the wisest thing, but even if one takes this at face value, a detected genetic sequence less than 30,000 base-pairs long with no verification that it does actually cause any disease in humans as the cultures are on immunocompromised monkey cells and/or are supposed to come from bats, renders this sequence meaningless.

For context 30,000 might sound like a big number, but in genetic terms it’s miniscule. To put it into perspective the bacterium E. coli has over 4.5 million base-pairs. Out of this less than 30,000 pairs that supposedly make up SARS-CoV-2 the tests are looking for sections less than 30 pairs long. From that article there is an image that illustrates this…

The RdRP section has four possible sequences they check for, and the E and N sections have three each.

Interestingly the section labelled with an “S” is the infamous “Spike Protein”, that thing everyone suddenly knows is part of the super-deadly virus. None of the three “tests” are checking the presence of the genetic sequence of one of the most “novel” aspects of this alleged virus.

SUMMARY

Public Health England are claiming to have “isolated” the SARS-CoV-2 virus.

This isolation is nothing more than a culture of some genetic material in a monkey kidney cell disconnected from a living body, that has been immunocompromised to encourage this material to allegedly replicate.

This culture then matches another sequence of just under 30,000 base-pairs of DNA, with no proof whatsoever that it is the causative agent in any disease.

When testing people for infection, they are using an amplification technique that relies on pulling apart DNA and reassembling it with supplied genetic material and matching sequences of base-pairs less than 30 in length.

The main “novel” aspect (or so it is claimed) of this virus is the S or spike protein and they don’t test for that.

Public Health England cited a “peer-reviewed” paper that states categorically that the PCR test cannot differentiate between infectious and non-infections genetic material.